View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_47 (Length: 226)
Name: NF10719_low_47
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 82 - 207
Target Start/End: Complemental strand, 41256247 - 41256122
Alignment:
| Q |
82 |
atatagtgatagtagtgctaaaggagtaatgtttatggagtagtaataatatatgtagctgcatatatacttaatttagggtagttagttattttgtctc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41256247 |
atatagtgatagtagtgctaaaggagtaatgtttatggagtagtaataatatatgtagctgcatatatacttaatttagggtagttagttattttgtctc |
41256148 |
T |
|
| Q |
182 |
tttattattacaagtactgcaagtgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41256147 |
tttattattacaagtactgcaagtgg |
41256122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University