View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_49 (Length: 224)
Name: NF10719_low_49
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 4951112 - 4951287
Alignment:
| Q |
1 |
tcaccagaacctccaccatcatttgtcctattggccctgtagtagttactctgttcaacaatggacacccttttggatgttctttcaaaacatatgatac |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4951112 |
tcaccagaacctccaccatcatttgtcatattggccctgtagtagttactcttttcaacaatggacacccttttggatgttctttcaaaacatatgatac |
4951211 |
T |
|
| Q |
101 |
attgttttactattgcacgtgcatcacctcattcctcttatctcccttgggcccacaaaagacaaaagttttctatt |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4951212 |
attgttttactattgcacgtgcat-acctcattcctcttatctcccttgggcccacaaaagacaaaagttttctatt |
4951287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 10484789 - 10484665
Alignment:
| Q |
1 |
tcaccagaacctccaccatcatttgtcctattggccctgtagtagttactctgttcaacaatggacaccctttt--ggatgttctttcaaaacatatgat |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
10484789 |
tcaccagaacctccaccatcatttgtcctattgaccct---gtagttactatgttcaacaatggacaccctttttctgatgttctttcaaaa-atatgat |
10484694 |
T |
|
| Q |
99 |
acattgttttactattgcacgtgcatcac |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10484693 |
acattgttttactattgcacgtgcatcac |
10484665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University