View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_50 (Length: 222)
Name: NF10719_low_50
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 38013444 - 38013259
Alignment:
| Q |
20 |
gaacaggtttaggtaggtcaaggttctcgagatcaaggttttctactcggttggtttgtgtgtctgagttgcatgagacacctttccatttattgttgca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38013444 |
gaacaggtttaggtaggtcaaggttctcgagatcaaggttttctactcggttggtttgtgtgtctgagttgcatgagacacctttccatttgttgttgca |
38013345 |
T |
|
| Q |
120 |
gcagtcagtgtttggatcccatgaagagagttggctagggttgccaaattcttttttgatttggagtagggttcttttgtcatctg |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38013344 |
gcagtctgtgtttggatcccatgaagagagttggctagggttgccaaattcttttttgatttggagtagggttcttttgtcatctg |
38013259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 113 - 205
Target Start/End: Complemental strand, 37989634 - 37989542
Alignment:
| Q |
113 |
tgttgcagcagtcagtgtttggatcccatgaagagagttggctagggttgccaaattcttttttgatttggagtagggttcttttgtcatctg |
205 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
37989634 |
tgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcatctg |
37989542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 81 - 187
Target Start/End: Original strand, 37697695 - 37697804
Alignment:
| Q |
81 |
gtctgagttgcatgagacacctttccatttattgttgcagcagtcagtgtt---tggatcccatgaagagagttggctagggttgccaaattcttttttg |
177 |
Q |
| |
|
|||||||| |||||||||||| |||||||| | ||||||||||||| |||| |||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
37697695 |
gtctgagtcgcatgagacacccttccatttgtcgttgcagcagtcattgttgtttggatcccatgaagagagtttggttgggttgccaaattcttttttg |
37697794 |
T |
|
| Q |
178 |
atttggagta |
187 |
Q |
| |
|
|||||||||| |
|
|
| T |
37697795 |
atttggagta |
37697804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 202
Target Start/End: Complemental strand, 37993823 - 37993735
Alignment:
| Q |
114 |
gttgcagcagtcagtgtttggatcccatgaagagagttggctagggttgccaaattcttttttgatttggagtagggttcttttgtcat |
202 |
Q |
| |
|
|||||||||||| || ||| ||||||||||||||||| | | ||||||||||||| |||||||||||| | |||||| ||||||||| |
|
|
| T |
37993823 |
gttgcagcagtcggtagttgaatcccatgaagagagtttggttgggttgccaaattgttttttgatttgaaagagggtttttttgtcat |
37993735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 200
Target Start/End: Complemental strand, 18138386 - 18138354
Alignment:
| Q |
168 |
ttcttttttgatttggagtagggttcttttgtc |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
18138386 |
ttctttcttgatttggagtagggttcttttgtc |
18138354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University