View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_52 (Length: 213)
Name: NF10719_low_52
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_52 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 17 - 123
Target Start/End: Complemental strand, 4720484 - 4720377
Alignment:
| Q |
17 |
ttttttatggaccaaataacaattggaaaattgttgttgacacttaaaataaaggttgaaaaacaccagtaaaatatgtaaata-tccctcagtagttaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| ||||| |||||||| |
|
|
| T |
4720484 |
ttttttatggaccaaataacaattggaaaattgttgttgacacttaacataaaggttgaaaaacaccagtaaaatacataaataccccctcggtagttaa |
4720385 |
T |
|
| Q |
116 |
ccatcaaa |
123 |
Q |
| |
|
||| |||| |
|
|
| T |
4720384 |
ccaccaaa |
4720377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 40 - 102
Target Start/End: Original strand, 22494812 - 22494873
Alignment:
| Q |
40 |
tggaaaattgttgttgacacttaaaataaaggttgaaaaacaccagtaaaatatgtaaatatc |
102 |
Q |
| |
|
|||||||||||||||||||||||| | || || |||||||||||||||||||| ||||||||| |
|
|
| T |
22494812 |
tggaaaattgttgttgacacttaacagaa-ggctgaaaaacaccagtaaaatacgtaaatatc |
22494873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 102
Target Start/End: Original strand, 9428881 - 9428940
Alignment:
| Q |
42 |
gaaaattgttgttgacacttaaaataaaggttgaaaaacaccagtaaaatatgtaaatatc |
102 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||||||||||| ||||||| | ||||||| |
|
|
| T |
9428881 |
gaaaattgttgttgacacttcacataa-ggttgaaaaacaccaataaaatacgcaaatatc |
9428940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 128 - 173
Target Start/End: Complemental strand, 251462 - 251417
Alignment:
| Q |
128 |
atgcgtcctttatacaaaaatagaagcatcattttcatatcagttt |
173 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| |||||||||||||| |
|
|
| T |
251462 |
atgcgtcctttatacataaacataagcatcagtttcatatcagttt |
251417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University