View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_8 (Length: 396)
Name: NF10719_low_8
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 1 - 388
Target Start/End: Complemental strand, 48861677 - 48861293
Alignment:
| Q |
1 |
actaccaagtaagcctttatcagtactaaaagaagaaccatagcaattgttgtcttcaattctaaaagatggagaccggaatctgttgctggttacatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48861677 |
actaccaagtaagcctttatcagtactaaaagaagaaccatagcaattgttgtcttcaattctaaaagatggagaacggaatctgttgctggttacatga |
48861578 |
T |
 |
| Q |
101 |
ggaccctgctgcaaaagggtgggtgagggtactaatagcaaccttggaggaagctccaaacacttgtcactactgggattagtgaagggcacaagtgcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48861577 |
ggaccctgctgcaaaagggtgggtgagggtactaatagcaaccttggaggaagctccaaacacttgtcactactgggattagtgaagggcacaagtgcat |
48861478 |
T |
 |
| Q |
201 |
tgcaaagccttggctttcctggttcttgttcccaaagaaatggtactgaacctgaggtttgcagtggtggagtcaccgtccccgttctctctggggattc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48861477 |
tgcaaagccttggctttcctggttcttgttcccaaagaaatggtactgaacctgaggtttgaagtggtggagtcaccgtccccgttctctctggggattc |
48861378 |
T |
 |
| Q |
301 |
catttgcatttgaattttcattgctgctggtgagacagagaacaaagggagcgttggtatgctgctgctctcttgctctgcctatgct |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
48861377 |
catttgcatttgaattttcattgctgctggtgagacagagaacaaagggagccttggtatgc---tgctctcttgctctgcctttgct |
48861293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University