View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_9 (Length: 388)
Name: NF10719_low_9
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 50369180 - 50368912
Alignment:
| Q |
1 |
ggtaaattcgtaattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgggtttgattaaag |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369180 |
ggtaaattcgtaattggtggtgattttccaacttttgctagctttggtaaggcttatgtatacggaacacccgttttggagtatccgggtttgattaaag |
50369081 |
T |
|
| Q |
101 |
ccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatgagttgaaggaatgggttgaagggatatttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369080 |
ccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatgagttgaaggaatgggttgaagggatatttgg |
50368981 |
T |
|
| Q |
201 |
tggggttgttgattcaagtgagccggtggtgaaacaatcttgcatgtattcaatgacaccagatgagga |
269 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50368980 |
tggggttgttgattcaagtgagccagtggtgaaacaatcttgcatgtattcaatgacaccagatgagga |
50368912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 12 - 269
Target Start/End: Complemental strand, 50379332 - 50379075
Alignment:
| Q |
12 |
aattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgggtttgattaaagccgcggtccat |
111 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||| ||||| | || ||| | || ||| |||| ||| ||||||||||| | || || || |
|
|
| T |
50379332 |
aattggtggtgattttccaacgtttgctagcttgggtagggttttattgtatggatcgccaagttttgagtttccaggtttgattaaggtggcagttcac |
50379233 |
T |
|
| Q |
112 |
ggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatgagttgaaggaatgggttgaagggatatttggtggggttgttg |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| |||||||||| ||||| ||||||| ||||||||||||| ||| ||||| | |||| |
|
|
| T |
50379232 |
ggtggtaacctgtgtgacccggataagagaccgtggggggcaggtgtgatgatggatgagatgaaggagtgggttgaagggagattctgtgggttggttg |
50379133 |
T |
|
| Q |
212 |
attcaagtgagccggtggtgaaacaatcttgcatgtattcaatgacaccagatgagga |
269 |
Q |
| |
|
||||| ||||| || |||||||| |||| |||||||||||||| || |||||||| |
|
|
| T |
50379132 |
attcatccgagcctgttgtgaaacaggcttgtatgtattcaatgactccggatgagga |
50379075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University