View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10720_high_12 (Length: 285)
Name: NF10720_high_12
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10720_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 325902 - 326159
Alignment:
| Q |
1 |
gtttagggtttatgttggtctctattttgcattagaattgattgacagagccgatattaaattttggcgattgatttgtcattttcgaatatttggaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
325902 |
gtttagggtttatgttggtctctattttgcattagaattgattgacagagccgatattaaattttggcgattgatttgtcattttcgaatatttggaatc |
326001 |
T |
 |
| Q |
101 |
aaattgtccgaccctcataaactgtttttgttattattgcattgcagatacacactactagtcagtcttcaccaatgcaggcatataaccagtctatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
326002 |
aaattgtccgaccctcataaactgtttttgttattattgcattgcagatacacactactagtcagtcttcaccaatgcaggcatataaccagtctatcaa |
326101 |
T |
 |
| Q |
201 |
tgatctagataaggaacttgatcatttgaagagtggctttgaggtatttatttaagtg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
326102 |
tgatctagataaggaacttgatcatttgaagagtggctttgaggtatttatttaagtg |
326159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 142 - 246
Target Start/End: Original strand, 13950157 - 13950261
Alignment:
| Q |
142 |
ttgcagatacacactactagtcagtcttcaccaatgcaggcatataaccagtctatcaatgatctagataaggaacttgatcatttgaagagtggctttg |
241 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||| ||||||||||| |||| |
|
|
| T |
13950157 |
ttgcagatacacacaaccagccagtcttcaccaatgcaagcatataaccagtctattaatgatctggataaggaacttgataccttgaagagtggttttg |
13950256 |
T |
 |
| Q |
242 |
aggta |
246 |
Q |
| |
|
||||| |
|
|
| T |
13950257 |
aggta |
13950261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University