View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10720_high_20 (Length: 233)
Name: NF10720_high_20
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10720_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 231
Target Start/End: Original strand, 49765989 - 49766210
Alignment:
| Q |
10 |
gaaactgaaaccgaacattgctttcatcctccatttacagcatcctcagcagaattagaagaaaaccaataagatgaagaagatgaatttgaagatgaag |
109 |
Q |
| |
|
||||||| ||| |||| ||| |||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
49765989 |
gaaactgtaacagaaccttgttttcctcctccatttacagcatcatcagcagaattagaagaaacccaataagatgaagtagatgaatttgaagatgaag |
49766088 |
T |
|
| Q |
110 |
atgatgtcatcatgaaaacactgaatattcctccacaccttctaagtactctctctttcatgcaatgatggtgatggtggtggtggtcttgagcacggtt |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766089 |
atgatgtcatcatgaaaccactgaatattcctccacaccttctaagtactctctctttcatgcaatgatggtgatggtggtggtggtcttgagcacggtt |
49766188 |
T |
|
| Q |
210 |
cacagaagcaataccattagaa |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49766189 |
cacagaagcaataccattagaa |
49766210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University