View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10720_high_21 (Length: 229)
Name: NF10720_high_21
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10720_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 116 - 213
Target Start/End: Complemental strand, 10426336 - 10426239
Alignment:
| Q |
116 |
ttaattcaacgcttcatcgtagtatctcggttctccacattattctctccttttcttctcacctatcccattttcccttatccttccaccctgttttt |
213 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10426336 |
ttaattcaacgcttcatcgtaatatctccgttctccacattattctctccttttcttctcacctatcccattttcccttatccttccaccctattttt |
10426239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 10426747 - 10426677
Alignment:
| Q |
14 |
gcacgttggaattgatcaatttgaatgatacacatgcctccaaggtcttatctagaatttacagggcttgct |
85 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
10426747 |
gcacattggaattgatcaatttgaatgatacacatgcct-caaggtcttatctagaatttacagagcttgct |
10426677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 90 - 213
Target Start/End: Original strand, 24819406 - 24819530
Alignment:
| Q |
90 |
gctattcttttcgtctttgttcctttttaattcaacgcttcatcgtagtatctcggttctccacattattctctccttttcttctcac-ctatcccattt |
188 |
Q |
| |
|
|||||||||||| ||| | ||| ||||||||||||||| ||||||| ||| | ||||||||||||| |||| ||||| |||||| ||||| ||| | |
|
|
| T |
24819406 |
gctattcttttcctctctattcaattttaattcaacgctccatcgtaatatgttcagtctccacattattttctctttttcctctcactctatcgcatct |
24819505 |
T |
 |
| Q |
189 |
tcccttatccttccaccctgttttt |
213 |
Q |
| |
|
||||| ||||||||||||| ||||| |
|
|
| T |
24819506 |
tccctcatccttccaccctattttt |
24819530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 4410888 - 4410938
Alignment:
| Q |
14 |
gcacgttggaattgatcaatttgaatgatacacatgcctccaaggtcttat |
64 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
4410888 |
gcacattggaattgatcaatgtgaatggtacacatgcctccaaggtcttat |
4410938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University