View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10720_low_21 (Length: 273)
Name: NF10720_low_21
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10720_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 32 - 266
Target Start/End: Complemental strand, 50529128 - 50528894
Alignment:
| Q |
32 |
atattaatgtagatcgatcctgaagcaccgttttcagcagcttttaaatccgacggatggggatgggcgtcaagagtgataggagtgggggccagttttg |
131 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529128 |
atatttatgtagatcgatcctgaagcaccgttttcagcagcttttaaatccgacggatggggatgggcgtcaagagtgataggagtgggggccagttttg |
50529029 |
T |
|
| Q |
132 |
gaatattgacatcattgatagttgctatgttgggtcaggctcgttatatgtgtgtcattggacgttctaatgtggtccctgcttggtttgctaaggtcca |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529028 |
gaatattgacatcattgatagttgctatgttgggtcaggctcgttatatgtgtgtcattggacgttctaatgtggtccctgcttggtttgctaaggtcca |
50528929 |
T |
|
| Q |
232 |
cccaaagacatccactcctgtcaacgcctatgctt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50528928 |
cccaaagacatccactcctgtcaacgcctctgctt |
50528894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University