View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10720_low_23 (Length: 256)
Name: NF10720_low_23
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10720_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 115 - 240
Target Start/End: Complemental strand, 26466798 - 26466673
Alignment:
| Q |
115 |
ttttgccaaatattagttttaaagttttggattgtatgaaatgcatattggaaaccacaaacatggtgataatactatcggaaagaagtgacatagaatg |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26466798 |
ttttgccaaatattagttttgaagttttggattgtatgaaatgcatattggaaaccacaaacatggtgataatactatcggaaagaagtgacatagaatg |
26466699 |
T |
|
| Q |
215 |
cgtgcatagaaaataaatgtcaataa |
240 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
26466698 |
cgtgcatagaaaataaatgtctataa |
26466673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 49 - 123
Target Start/End: Complemental strand, 26467066 - 26466992
Alignment:
| Q |
49 |
taataaagatcgaaatatgtcatagaccgatgaagtatatactagcatgtagcatgaacgtgatagttttgccaa |
123 |
Q |
| |
|
|||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26467066 |
taataaagttagaaatatgtcacagaccgatgaagtatatactagcatgtagcatgaacgtgatagttttgccaa |
26466992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 26473705 - 26473666
Alignment:
| Q |
16 |
gaagaaacaaaaggccactcttgtcaaacaaaataataaa |
55 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26473705 |
gaagaaacaaaaggccacttttgtcaaacaaaataataaa |
26473666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University