View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10720_low_29 (Length: 239)
Name: NF10720_low_29
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10720_low_29 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 178148 - 178375
Alignment:
| Q |
16 |
actacaatactatactcacatggaaactttactattatccaaaattctcaaatacatggtgattacaaggttggaatctatctannnnnnnnnnnnnn-- |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
178148 |
actacaatactatagtcacatggaaactttactattatccaaaattctcaaatacatggtgattacagggttggaatctatctatctatttttttttttt |
178247 |
T |
|
| Q |
114 |
--acagaagaaactagaaatcaccaatatttcagaagcagacatatattaacccttaatttcaccttaaagtttgttaaacttaattacttggttatgag |
211 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
178248 |
ttaaagaggaaactagaaatcaccaatatttcagaagcactcatatattaacccttaatttcaccttaaaatttgttaaacttaattacttggttatgag |
178347 |
T |
|
| Q |
212 |
atgagaactattatcctttagattaaac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
178348 |
atgagaactattatcctttagattaaac |
178375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University