View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10720_low_30 (Length: 238)
Name: NF10720_low_30
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10720_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 52287568 - 52287775
Alignment:
| Q |
15 |
aagaatcagatggtgaaatattgcaggactcaaatggtgtgccggtgatcggcgttgtaaaagtagtagtggctaatggagtgctatagaactcttcaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52287568 |
aagaatcagatggtgaaatattgcaggactcaaatggtgtgccggtgatcggcgttgtaaaagtagtagtggctaatggagtgctatagaactcttcaaa |
52287667 |
T |
|
| Q |
115 |
gatatctttttcaacctcaaaaggtttgtgagggttttgaaggagtttttcaaccatttgtaaccgaggtggaaggtgaagggggaggagttttcctttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52287668 |
gatatctttttcaacctcaaaaggtttgtgagggttttgaaggagtttttcaaccatttgtaaccgaggtggaaggtgaagggggaggagttttcctttg |
52287767 |
T |
|
| Q |
215 |
tagaaaag |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
52287768 |
tagaaaag |
52287775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University