View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10720_low_7 (Length: 386)

Name: NF10720_low_7
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10720_low_7
NF10720_low_7
[»] chr8 (6 HSPs)
chr8 (66-177)||(13629328-13629439)
chr8 (66-177)||(13729740-13729851)
chr8 (245-370)||(13628835-13628952)
chr8 (245-370)||(13729247-13729364)
chr8 (1-49)||(13629462-13629510)
chr8 (1-49)||(13729874-13729922)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 66 - 177
Target Start/End: Complemental strand, 13629439 - 13629328
Alignment:
66 atatattggaatatgcaacacaacatactttacacctgaaaaattgttgcttaaagtttcagtcatagttttattggaaatgctaaagaatagaaatttt 165  Q
    |||||||||||||||||| ||| | ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
13629439 atatattggaatatgcaagacagcgtactttacacctgaaaaatcgttgcttaaagttttagtcatagttttattggaaatgctaaagaatagaaatttt 13629340  T
166 atattgaaaatt 177  Q
    ||||||||||||    
13629339 atattgaaaatt 13629328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 66 - 177
Target Start/End: Complemental strand, 13729851 - 13729740
Alignment:
66 atatattggaatatgcaacacaacatactttacacctgaaaaattgttgcttaaagtttcagtcatagttttattggaaatgctaaagaatagaaatttt 165  Q
    |||||||||||||||||| ||| | ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
13729851 atatattggaatatgcaagacagcgtactttacacctgaaaaatcgttgcttaaagttttagtcatagttttattggaaatgctaaagaatagaaatttt 13729752  T
166 atattgaaaatt 177  Q
    ||||||||||||    
13729751 atattgaaaatt 13729740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 245 - 370
Target Start/End: Complemental strand, 13628952 - 13628835
Alignment:
245 ttagcacaaccctagttttattgtttttactacggtttgatattgttgtctaaattgctttttattgtaactttgctccttttacctagatcaataatcg 344  Q
    |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||        |    
13628952 ttagcataaccctagttttattggttttactacggtttgatattgttgtctaaattgctttttattgtaactttgcaccttttacctagat--------g 13628861  T
345 tattttcagattttgtgcgataaaaa 370  Q
    ||||||||||||||||||||||||||    
13628860 tattttcagattttgtgcgataaaaa 13628835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 245 - 370
Target Start/End: Complemental strand, 13729364 - 13729247
Alignment:
245 ttagcacaaccctagttttattgtttttactacggtttgatattgttgtctaaattgctttttattgtaactttgctccttttacctagatcaataatcg 344  Q
    |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||        |    
13729364 ttagcataaccctagttttattggttttactacggtttgatattgttgtctaaattgctttttattgtaactttgcaccttttacctagat--------g 13729273  T
345 tattttcagattttgtgcgataaaaa 370  Q
    ||||||||||||||||||||||||||    
13729272 tattttcagattttgtgcgataaaaa 13729247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 13629510 - 13629462
Alignment:
1 acgtgatctgatctcacattttagacactttgatgaatcatgtgaatag 49  Q
    ||||||| || ||||||||||||||||||| ||||||||||||||||||    
13629510 acgtgatatgttctcacattttagacacttggatgaatcatgtgaatag 13629462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 13729922 - 13729874
Alignment:
1 acgtgatctgatctcacattttagacactttgatgaatcatgtgaatag 49  Q
    ||||||| || ||||||||||||||||||| ||||||||||||||||||    
13729922 acgtgatatgttctcacattttagacacttggatgaatcatgtgaatag 13729874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University