View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10721_high_7 (Length: 240)
Name: NF10721_high_7
Description: NF10721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10721_high_7 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 104 - 240
Target Start/End: Original strand, 9283261 - 9283406
Alignment:
| Q |
104 |
caagtttaatcttttttgttaaaagaacacaacctactaaaaataaaaatactcttacatacaccaaaactcaaggtcactcacaccatac--------- |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
9283261 |
caagtttaatcttttttgttaaaagaacacaacctactaaaaata------ctcttacatacaccaaaactcaaggccactgacaccatacctgctaaaa |
9283354 |
T |
 |
| Q |
195 |
------aaacatgcatgaaacagaagctaagctgactagcagatcacaaaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9283355 |
ccactgaaacatgcatgaaacagaagctaagctgactagcagatcacaaaat |
9283406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 9283233 - 9283279
Alignment:
| Q |
18 |
catttgtctaaacttatgcaaattgttacaagtttaatcttttttgt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9283233 |
catttgtctaaacttatgcaaattgttacaagtttaatcttttttgt |
9283279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University