View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10721_low_15 (Length: 250)

Name: NF10721_low_15
Description: NF10721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10721_low_15
NF10721_low_15
[»] chr3 (2 HSPs)
chr3 (113-215)||(8650012-8650114)
chr3 (1-62)||(8650165-8650226)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 113 - 215
Target Start/End: Complemental strand, 8650114 - 8650012
Alignment:
113 aaagatccagtctgagaggaaacaaaacgaaaatcaaagagaatctgacgattatgaaagattctgtcatgttctcatgctcaatctcacatgaaaaccc 212  Q
    ||||||||||| ||||||||| |||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||    
8650114 aaagatccagtatgagaggaatcaaaacgaaaatcaaagagaatatgacgattacgaaagattttgtcatgttctcatgctcaatctcacatgaaaaccc 8650015  T
213 tag 215  Q
    |||    
8650014 tag 8650012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 8650226 - 8650165
Alignment:
1 atggaagagaaaacatagataaaattaaatgaaagcatnnnnnnntggaaattgaagctcga 62  Q
    ||||||||||||||||| ||||||| ||||||||| ||       |||||||||||||||||    
8650226 atggaagagaaaacataaataaaatgaaatgaaagtatgaaaaaatggaaattgaagctcga 8650165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University