View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10721_low_16 (Length: 250)
Name: NF10721_low_16
Description: NF10721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10721_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 9231952 - 9231716
Alignment:
| Q |
1 |
tagacaattttgatggaataggataaaaattgaagcaaatatttttaccaatgtttgtagttgtacaaatgatgaacaagaaaatcgagcttgtcttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9231952 |
tagacaattttgatggaataggataaaaattgaagcaaatatttttaccaatgtttgtagttgtacaaatgatgaacaagaaaattgagcttgtcttttc |
9231853 |
T |
|
| Q |
101 |
atcattcaagtcttcnnnnnnntatgaaattttttaaaacaagccctcatgagaaaatgttgtgattggtttatgtttttaaattttataaatgggtcaa |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9231852 |
atcattcaagtcttcaaaaaaatatgaaattttttaaaacaagccctcatgagaaaatgttgtgattggtttatgttttttaattttataaatgggtcaa |
9231753 |
T |
|
| Q |
201 |
tcatttatcattaggttgccaccatatctagctgtct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9231752 |
tcatttatcattaggttgccaccatatctagctgtct |
9231716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University