View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10721_low_19 (Length: 240)
Name: NF10721_low_19
Description: NF10721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10721_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 113 - 213
Target Start/End: Original strand, 29415833 - 29415933
Alignment:
| Q |
113 |
tctgggcagcatcgtgatttgaaattccaaatcaatcaatcaattgaaaattgaggtgagtaacaattacgattcaattcgatcgataccacatcatttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29415833 |
tctgggcagcatcgtgatttgaaattccaaatcaatcaatcaactgaaaattgaggtgagtaacgattacgattcaattcgatcgataccacatcatttc |
29415932 |
T |
 |
| Q |
213 |
a |
213 |
Q |
| |
|
| |
|
|
| T |
29415933 |
a |
29415933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University