View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10721_low_20 (Length: 239)
Name: NF10721_low_20
Description: NF10721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10721_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 53676784 - 53677006
Alignment:
| Q |
1 |
cattgagaccctctccacataagaatgactcgactaaacaatcttcgacttttctaatatcaatttattatacactcggctatagaaactgacttaccct |
100 |
Q |
| |
|
||||||| ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||| |
|
|
| T |
53676784 |
cattgagcccctctccatataagaatgattcgactaaacaatcttcgacttttctaatatcaattgattatacactcggctatagaaattaacttaccct |
53676883 |
T |
 |
| Q |
101 |
aaattttgcttcatgtcgttcccagcttacaatttagaatattttttagtgtaaacaaatgtccaactgattgtagcatgatgaaccgaaaatccattac |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
53676884 |
aaattttgcttcatgtcgttcccggcttacaatttagaatattttttagtgtaaacaaatgtccaactgattgtagcacgatgagccgaaaatccattac |
53676983 |
T |
 |
| Q |
201 |
atgttacttttaggactcataaa |
223 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
53676984 |
atgttacttttagggctcataaa |
53677006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University