View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10721_low_28 (Length: 222)
Name: NF10721_low_28
Description: NF10721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10721_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 56229162 - 56229354
Alignment:
| Q |
15 |
agagaagttggtacaa-catattcgag-tttaggtggtgtttatttgaagtaaattagatttacttctaggaataatatttttgagaatataagaagact |
112 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56229162 |
agagaagttggtacaaacatattcgagctttaggtggtgtttatttgaagtaaattagatttacttctaggaataatatttttgagaatataagaagact |
56229261 |
T |
|
| Q |
113 |
ttttatgtttgttagtaaaatatttattaaatggcatttatgggaataga--acttctcccaaagaaaatgatgggataaaatttcaacggaac |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56229262 |
ttttatgtttgttagtaaaa-atttattaaatggcatttatgggaatagaagacttctcccaaagaaaatgatgggataaaatttcaacggaac |
56229354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University