View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10721_low_6 (Length: 366)
Name: NF10721_low_6
Description: NF10721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10721_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 6047260 - 6047474
Alignment:
| Q |
1 |
aatttttggagaatacaacgagagatatgcgtgagtcttggattgcttcagcaagtgcttcaccaatatcatctccctttacaagattatcatcaatgta |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
6047260 |
aatttttggagaatacaacaagagatatgcgtgagtcttggattgcttcagcaagtgcttcaccaatttcatctcccttcacaagattatcatcaatgta |
6047359 |
T |
 |
| Q |
101 |
tgctatgatattttccttgcagagagcataatgaagatggcttgtgaatgtttcacgtgtgtcttggcccctaaaactgatgaacacatcgtactttttc |
200 |
Q |
| |
|
|| |||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6047360 |
tgttatgatattttccttgcataaagcataatgaagatggcttgtgaatgtttcacgcgtgtcttggcccctgaaactgatgaacacatcgtactttttc |
6047459 |
T |
 |
| Q |
201 |
gaagaggtagacatg |
215 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
6047460 |
gaagaggtggacatg |
6047474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 9 - 118
Target Start/End: Original strand, 6097929 - 6098038
Alignment:
| Q |
9 |
gagaatacaacgagagatatgcgtgagtcttggattgcttcagcaagtgcttcaccaatatcatctccctttacaagattatcatcaatgtatgctatga |
108 |
Q |
| |
|
||||| || |||||||| || ||||| ||||||||||||| | |||||||| ||||| || ||||| || |||||| || |||||||||| ||||| |
|
|
| T |
6097929 |
gagaaaaccacgagagacatacgtgattcttggattgcttgaacaagtgctggaccaacctcttctcctttgttaagattctcgtcaatgtatgttatga |
6098028 |
T |
 |
| Q |
109 |
tattttcctt |
118 |
Q |
| |
|
|||||||||| |
|
|
| T |
6098029 |
tattttcctt |
6098038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University