View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10721_low_6 (Length: 366)

Name: NF10721_low_6
Description: NF10721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10721_low_6
NF10721_low_6
[»] chr8 (2 HSPs)
chr8 (1-215)||(6047260-6047474)
chr8 (9-118)||(6097929-6098038)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 6047260 - 6047474
Alignment:
1 aatttttggagaatacaacgagagatatgcgtgagtcttggattgcttcagcaagtgcttcaccaatatcatctccctttacaagattatcatcaatgta 100  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||    
6047260 aatttttggagaatacaacaagagatatgcgtgagtcttggattgcttcagcaagtgcttcaccaatttcatctcccttcacaagattatcatcaatgta 6047359  T
101 tgctatgatattttccttgcagagagcataatgaagatggcttgtgaatgtttcacgtgtgtcttggcccctaaaactgatgaacacatcgtactttttc 200  Q
    || |||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||    
6047360 tgttatgatattttccttgcataaagcataatgaagatggcttgtgaatgtttcacgcgtgtcttggcccctgaaactgatgaacacatcgtactttttc 6047459  T
201 gaagaggtagacatg 215  Q
    |||||||| ||||||    
6047460 gaagaggtggacatg 6047474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 9 - 118
Target Start/End: Original strand, 6097929 - 6098038
Alignment:
9 gagaatacaacgagagatatgcgtgagtcttggattgcttcagcaagtgcttcaccaatatcatctccctttacaagattatcatcaatgtatgctatga 108  Q
    ||||| || |||||||| || ||||| ||||||||||||| | ||||||||  |||||  || ||||| ||   |||||| || |||||||||| |||||    
6097929 gagaaaaccacgagagacatacgtgattcttggattgcttgaacaagtgctggaccaacctcttctcctttgttaagattctcgtcaatgtatgttatga 6098028  T
109 tattttcctt 118  Q
    ||||||||||    
6098029 tattttcctt 6098038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University