View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10722_high_43 (Length: 234)
Name: NF10722_high_43
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10722_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 15 - 112
Target Start/End: Complemental strand, 11127347 - 11127250
Alignment:
| Q |
15 |
aggtagagtttggtcaccatacggtgggttgcagttgaactatggtgatcccacatcaggcggtggtagaactttgttggcagatcacttcccaccct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
11127347 |
aggtagagtttggtcaccatacggtgggttgcagttgaactatggtaaccccacatcaggcggtggtagaacttcgttggccgatcacttcccaccct |
11127250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University