View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10722_high_50 (Length: 227)
Name: NF10722_high_50
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10722_high_50 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 43164331 - 43164105
Alignment:
| Q |
1 |
agcagtacaacacacacttaaaagctgatctggactcacacgggcagaatgatctctactcttcgatcgctgaatgtcatttgtgtgttgaatgacctcg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164331 |
agcagtacaacacacactcaaaagctgatctggactcacacgggcagaatgatctctgctcttcgatcgctgaatgtcatttgtgtgttgaatgacctcg |
43164232 |
T |
 |
| Q |
101 |
aattcgacatgaagatttctatccttcacaagagtgacctcaaaaacagttaatggcaacctttcagtcactcacaaatagcttgttgtctaattttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43164231 |
aattcgacatgaagatttctatccttcacaagagtgacctcaaaaacagttaatggcaacctttcagtcactcacaaatagccagttgtctaattttcaa |
43164132 |
T |
 |
| Q |
201 |
accctttacattttgtttttaggtttc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43164131 |
accctttacattttgtttttaggtttc |
43164105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University