View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10722_low_11 (Length: 369)
Name: NF10722_low_11
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10722_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 513459 - 513826
Alignment:
| Q |
1 |
ttactctccatcaccaacaatctccgattctctctcactgtccgtattcaaaccctccctttcctccctcgcctcctccgtagatttaccaacctcacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
513459 |
ttactctccatcaccaacaatctccgattctctctcactgtccgtattcaaaccctccctttcctccctcgcctcctccgtagatttaccaacctcacct |
513558 |
T |
|
| Q |
101 |
acctcgacctcaagcgcttctccgaacacggcgaccttgatgctcttctccgtcaaattgcttgtttcccattgaagaaactcacaactctcaatatctc |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
513559 |
acctcgacctcaagcgcttctccaaacacggcgaccttgatgctcttctccgtcaaattgcttgtttcccattgaagaaactcacaactcttaatatctc |
513658 |
T |
|
| Q |
201 |
cgatcaacttcattttccctctaagggattgcgagatttctctaaacggattacaactttgacctctctcatttcttacggaattattaccctcaagacc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
513659 |
cgatcaacttcattttccctctaagggattgcgagatttctctaaacggattacaactttgacctctctcatttcttacggaattattaccctcaagacc |
513758 |
T |
|
| Q |
301 |
tctcacttatttctcattgccaactgtttccccttgcttgaagaactcgacctcagtggcctttgctt |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
513759 |
tctcacttatttctcattgccaactgtttccccttgcttgaagaactcgacctcagtggcccttgctt |
513826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 300 - 339
Target Start/End: Complemental strand, 371474 - 371435
Alignment:
| Q |
300 |
ctctcacttatttctcattgccaactgtttccccttgctt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371474 |
ctctcacttatttctcattgccaactgtttccccttgctt |
371435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 6007696 - 6007626
Alignment:
| Q |
4 |
ctctccatcaccaacaatctccgattctctctcactgtccgtattcaaaccctccctttcctccctcgcct |
74 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| || || || ||| ||||||| |||||||||||| |
|
|
| T |
6007696 |
ctctccatcaccaacagtctccgattctctctcactatctgtcatccaactctcccttccctccctcgcct |
6007626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 215
Target Start/End: Complemental strand, 371533 - 371479
Alignment:
| Q |
161 |
cttgtttcccattgaagaaactcacaactctcaatatctccgatcaacttcattt |
215 |
Q |
| |
|
||||||||| |||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
371533 |
cttgtttccaattgaaacaactaacaactctgaatatctccgatcaacttcattt |
371479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 62 - 110
Target Start/End: Complemental strand, 532947 - 532899
Alignment:
| Q |
62 |
tcctccctcgcctcctccgtagatttaccaacctcacctacctcgacct |
110 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
532947 |
tcctccctcgcctcttccgtagattcaccaacctcacctcccttgacct |
532899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 2391030 - 2391061
Alignment:
| Q |
1 |
ttactctccatcaccaacaatctccgattctc |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2391030 |
ttactctccatcaccaacaatctccgattctc |
2391061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 4 - 100
Target Start/End: Complemental strand, 548284 - 548188
Alignment:
| Q |
4 |
ctctccatcaccaacaatctccgattctctctcactgtccgtattcaaaccctccctttcctccctcgcctcctccgtagatttaccaacctcacct |
100 |
Q |
| |
|
|||||||||||||| ||||| | | |||| ||||| ||| || |||||| | |||||| || ||||||||| || ||||||||| |||||||||| |
|
|
| T |
548284 |
ctctccatcaccaataatcttccactctcactcacagtctataatcaaacacgcccttttcttcctcgcctcttcattagatttactaacctcacct |
548188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 38266333 - 38266390
Alignment:
| Q |
51 |
aaccctccctttcctccctcgcctcctccgtagatttaccaacctcacctacctcgac |
108 |
Q |
| |
|
|||| |||||||| | ||||| ||| |||||||||| ||||||||||||| ||||||| |
|
|
| T |
38266333 |
aaccgtccctttcatacctcgtctcttccgtagattcaccaacctcacctccctcgac |
38266390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 48 - 100
Target Start/End: Original strand, 34935821 - 34935873
Alignment:
| Q |
48 |
tcaaaccctccctttcctccctcgcctcctccgtagatttaccaacctcacct |
100 |
Q |
| |
|
|||||||||||||| ||| ||||||||| ||| || |||||||||||||||| |
|
|
| T |
34935821 |
tcaaaccctcccttcccttcctcgcctcttccaaaggtttaccaacctcacct |
34935873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University