View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10722_low_36 (Length: 248)
Name: NF10722_low_36
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10722_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 52600671 - 52600453
Alignment:
| Q |
18 |
aatataatagtaacattggtgcatcatgattaagactttaagaattcaggttatcattgtcaggtcaaaattgtgtatcaaagtaagtatcattagattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52600671 |
aatataatagtaacattggtgcatcatgattaagactttaagaattcaggttctcattgtcaggtcaaaattgtgtatcaaagtaagtatcattagattt |
52600572 |
T |
 |
| Q |
118 |
agtacctatattatacctgatagacagggccaaatccaccacttccaagaagatatctgcggtggaaattcttggtggcttttctcaatgtctggaaatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52600571 |
agtacctatattatacctgatagacagggccaaatccaccacttccaagaagatatctgcggtggaaattcttggtggcttttctcaatgtctggaaatc |
52600472 |
T |
 |
| Q |
218 |
aaagtagctaattgtccta |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52600471 |
aaagtagctaattgtccta |
52600453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 229
Target Start/End: Original strand, 16912588 - 16912687
Alignment:
| Q |
130 |
atacctgatagacagggccaaatccaccacttccaagaagatatctgcggtggaaattcttggtggcttttctcaatgtctggaaatcaaagtagctaat |
229 |
Q |
| |
|
|||||| ||| ||||| ||||||||||||||||||||||||| || | ||| || ||||| || || ||||| |||||| |||||||||||||||| |
|
|
| T |
16912588 |
ataccttatatacaggtccaaatccaccacttccaagaagatttccatgaaagaagttattggttgccttcctcaacgtctggtaatcaaagtagctaat |
16912687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University