View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10722_low_41 (Length: 241)
Name: NF10722_low_41
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10722_low_41 |
 | |
|
| [»] chr8 (4 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 147 - 241
Target Start/End: Original strand, 18035005 - 18035099
Alignment:
| Q |
147 |
ttgagcgcccagtttttggaggtatgtgaaaaattgggcgccttttctctcttaccctatagaaattgttggttggaatttcagttgcaatattt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
18035005 |
ttgagcgcccagtttttggaggtatgtgaaaaattgggcgccttttctctcttaccctatagaaattgttggttggaatttcggttgctatattt |
18035099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 172 - 233
Target Start/End: Original strand, 18020792 - 18020853
Alignment:
| Q |
172 |
gtgaaaaattgggcgccttttctctcttaccctatagaaattgttggttggaatttcagttg |
233 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
18020792 |
gtgaaaaattgggcaccttttctctcttaccttgtagaaattgttggttggaatctcagttg |
18020853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 18034878 - 18034962
Alignment:
| Q |
19 |
tgggttccatatgtaaggtttaggcaaaggagattatgctgggnnnnnnnnnnnnatgtgaggagttcttgttgtgtcagaggaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18034878 |
tgggttccatatgtaaggtttaggcaaaggagtttatgctgggttttttgtttttatgtgaggagttcttgttgtgtcagaggaa |
18034962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 61
Target Start/End: Original strand, 18020633 - 18020670
Alignment:
| Q |
24 |
tccatatgtaaggtttaggcaaaggagattatgctggg |
61 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
18020633 |
tccatatgtaaggtttaagcaaaggggattatgctggg |
18020670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University