View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10722_low_42 (Length: 241)

Name: NF10722_low_42
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10722_low_42
NF10722_low_42
[»] chr6 (1 HSPs)
chr6 (109-150)||(27974601-27974642)


Alignment Details
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 150
Target Start/End: Complemental strand, 27974642 - 27974601
Alignment:
109 gtgagtcaatacaaaatttcagcatgaagttttagtctcttc 150  Q
    |||||| ||||||||||||||||||||||||| |||||||||    
27974642 gtgagtaaatacaaaatttcagcatgaagtttcagtctcttc 27974601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University