View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10722_low_42 (Length: 241)
Name: NF10722_low_42
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10722_low_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 150
Target Start/End: Complemental strand, 27974642 - 27974601
Alignment:
| Q |
109 |
gtgagtcaatacaaaatttcagcatgaagttttagtctcttc |
150 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27974642 |
gtgagtaaatacaaaatttcagcatgaagtttcagtctcttc |
27974601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University