View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10722_low_55 (Length: 227)
Name: NF10722_low_55
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10722_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 10474436 - 10474367
Alignment:
| Q |
9 |
atttgttgacgcatctgaaccgcataagagattttactgcgagaaaggatagtacttcaaccaccagttc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10474436 |
atttgttgacgcatctgaaccgcataagagattttactgcgagaaaggatagtacttcagccaccagttc |
10474367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 10463494 - 10463425
Alignment:
| Q |
9 |
atttgttgacgcatctgaaccgcataagagattttactgcgagaaaggatagtacttcaaccaccagttc |
78 |
Q |
| |
|
||||||||||||| ||||| |||||||||| |||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
10463494 |
atttgttgacgcacctgaatcgcataagaggttttactgcgagcagggatagtacttcagccaccagttc |
10463425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 99 - 227
Target Start/End: Complemental strand, 10463380 - 10463248
Alignment:
| Q |
99 |
ccatggagccgccttgcatgtggttaggtagaagaattaaccctagaaag----tgaa-ccaaaacgaagcaaccaggttgaatattgcgacgttttaat |
193 |
Q |
| |
|
|||||| |||||| |||||||||| | |||||||||||||||||| ||| |||| ||||||| ||||||||| ||||||| ||| || ||||||| |
|
|
| T |
10463380 |
ccatggtgccgccgtgcatgtggtcacctagaagaattaaccctagcaagcaactgaaaccaaaactaagcaaccaagttgaatcgtgcaac-ttttaat |
10463282 |
T |
|
| Q |
194 |
atttgtttctttctgggctgttgtataatgggtt |
227 |
Q |
| |
|
|| ||||||||| |||||| |||||||||||||| |
|
|
| T |
10463281 |
atatgtttctttttgggcttttgtataatgggtt |
10463248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University