View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10722_low_62 (Length: 201)
Name: NF10722_low_62
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10722_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 4e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 78 - 184
Target Start/End: Original strand, 47094327 - 47094433
Alignment:
| Q |
78 |
agtaagaagatgatgaacgtgtttgagtggtttgttttgggtgccattgttgaatagaggtgagatgagtgatgagaatgtttgttgttcatttgaaata |
177 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47094327 |
agtaagaagatgatgaaagtgtttgagtggtttgttttgggtgccattgttgaatagaggtgagatgagtgatgagaatgttttttgttcatttgaaata |
47094426 |
T |
 |
| Q |
178 |
gttgtta |
184 |
Q |
| |
|
||||||| |
|
|
| T |
47094427 |
gttgtta |
47094433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University