View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10723_low_1 (Length: 280)
Name: NF10723_low_1
Description: NF10723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10723_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 2 - 165
Target Start/End: Complemental strand, 28076781 - 28076624
Alignment:
| Q |
2 |
agcaaaatgtctatgacatgtgtcagatgataagtaatggcaggtaacgagaagaaatcgaagtcaacatggaaacaaacagtgaactcacaggtcaaat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||| |||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
28076781 |
agcaaaatgtctatgacatgtgtcagatgataagtaacggcaagtaacgggaagaaatccaagtcaacatgg----aaatagtgaactcacaggttaaat |
28076686 |
T |
|
| Q |
102 |
ataaatatatttttacttgaaaaaattattttggacgagatccttgatgcaacagttgaatttc |
165 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28076685 |
ataa--atatttttacttgaaaaaattattttggacgagatccttaatgtaacagttgaatttc |
28076624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University