View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10723_low_1 (Length: 280)

Name: NF10723_low_1
Description: NF10723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10723_low_1
NF10723_low_1
[»] chr4 (1 HSPs)
chr4 (2-165)||(28076624-28076781)


Alignment Details
Target: chr4 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 2 - 165
Target Start/End: Complemental strand, 28076781 - 28076624
Alignment:
2 agcaaaatgtctatgacatgtgtcagatgataagtaatggcaggtaacgagaagaaatcgaagtcaacatggaaacaaacagtgaactcacaggtcaaat 101  Q
    ||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||| ||||||||||||    ||| ||||||||||||||| ||||    
28076781 agcaaaatgtctatgacatgtgtcagatgataagtaacggcaagtaacgggaagaaatccaagtcaacatgg----aaatagtgaactcacaggttaaat 28076686  T
102 ataaatatatttttacttgaaaaaattattttggacgagatccttgatgcaacagttgaatttc 165  Q
    ||||  ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||    
28076685 ataa--atatttttacttgaaaaaattattttggacgagatccttaatgtaacagttgaatttc 28076624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University