View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10723_low_5 (Length: 226)
Name: NF10723_low_5
Description: NF10723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10723_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 9571979 - 9572175
Alignment:
| Q |
17 |
atgtggttattgggatattaccttgtttaccctctttactattttcaaacttatttggtttttatatcaaggaaaagaatgatatgttgccctaactaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9571979 |
atgtggttattgggatattaccttgtttaccctctttactatcttcaaacttatttggtttttatatcaaggaaaagaatgatattttgccctaactaac |
9572078 |
T |
|
| Q |
117 |
ctctagtatcatgtagaaataacttgataatctaatgagcagcaaatctctctttgaaattctattacattcttccagaaattatgtatcccctatg |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9572079 |
ctcttgtatcatgtagaaataacttgataatctaatgagcagcaaatctctctttgaaattctattacattcttccagaaattatgtatccactatg |
9572175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 37898221 - 37898303
Alignment:
| Q |
18 |
tgtggttattgggatattaccttgtttaccctctttactattttcaaacttatttggtttttatatcaaggaaaagaatgatat |
101 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||| |||||| ||| || | ||||| | |||||||| |||||||||||||| |
|
|
| T |
37898221 |
tgtggttattgggatattgccttgtttagtctcttt-ctatttgcaagctaacttggtgtctatatcaatgaaaagaatgatat |
37898303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 187
Target Start/End: Original strand, 29140904 - 29140954
Alignment:
| Q |
137 |
aacttgataatctaatgagcagcaaatctctctttgaaattctattacatt |
187 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||| || |||||||| |
|
|
| T |
29140904 |
aacttgataatctaatgagcaacaaatctctatttgaactttcattacatt |
29140954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University