View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10725_high_10 (Length: 270)
Name: NF10725_high_10
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10725_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 262
Target Start/End: Original strand, 19805489 - 19805732
Alignment:
| Q |
19 |
tcaactctttttatctcacgatcataagttgttctaaattcttggagactgaggctgactgcttcgacaaatgggtcgaagcagcaaaacaacgtcatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
19805489 |
tcaactctttttatctcacgatcataagttgttctaaattcttggagactgaggctgactgcttcgacaaatgggtcgaagcagcaaaacaacgtcgtgt |
19805588 |
T |
|
| Q |
119 |
caaggatctccagctacactttttaccttcgatacatgcccctttagcgcctacagtcttctgctgcaaaacacttgtggttttgggtttgacgggaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||| ||||| ||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
19805589 |
caaggatctccagctacactttttaccttcgatacacgtccctttagcacctactgtcttctgctgcaaaacacttgtggttctaggtttgacgggaata |
19805688 |
T |
|
| Q |
219 |
catataggcactttgtttcatggttatattgatcttcctttgct |
262 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
19805689 |
catataggcactttgtttcatggttctgttgatcttcctttgct |
19805732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University