View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10725_high_18 (Length: 239)
Name: NF10725_high_18
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10725_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42982373 - 42982162
Alignment:
| Q |
1 |
aaatggaaactataattctttgggaatttcttt-ccccccattgtctcttctcgcacgccctattcaaattataaaatacgaaaaaatggagggtttgta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42982373 |
aaatggaaactataattctttgggaatttcttttccccccattgtctcttctcgcacgccctattcaaattataaaatgcgaaaaaatggagggttt--- |
42982277 |
T |
 |
| Q |
100 |
aaggtgtttagcatgttttggaggatgtttaaagcttttcgaattataaaaaacaaaattcgtagggtgcttgaaaaactaatacgatggaaatgaattt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
42982276 |
---------agcatgttttggaggatgtttaaagcttttcggattataaaatacaaaattcgtagggtgcgtgaaaaattaatacgatggaaatgaattt |
42982186 |
T |
 |
| Q |
200 |
ttaccatcagatcaaggagattct |
223 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
42982185 |
ttaccatcaaatcaaggagattct |
42982162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 96
Target Start/End: Original strand, 34267321 - 34267386
Alignment:
| Q |
31 |
tttccccccattgtctcttctcgcacgccctattcaaattataaaatacgaaaaaatggagggttt |
96 |
Q |
| |
|
|||||| || || |||||||||| | ||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34267321 |
tttcccacccttctctcttctcgtatacccaattcgaattataaaatccgaaaaaatggagggttt |
34267386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University