View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10725_high_19 (Length: 237)
Name: NF10725_high_19
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10725_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 29146657 - 29146878
Alignment:
| Q |
5 |
gtaagtattttccgttatttgttacctttttccttnnnnnnnnnnnngtttgttaccttttttgttgtcnnnnnnnntattatttaatctaaccctagta |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29146657 |
gtaagtattttccgttatttgttacctttttcctttaaaaaaaaaaagtttgttaccttttttgttgtcaaaaaaaatattatttaatctaaccctagta |
29146756 |
T |
|
| Q |
105 |
tatccttcnnnnnnnttcctagtatatacaattaattttgccgtcaggttttgtttgagagtttccggtcgta--gcccgtcaacgtttgacataaggta |
202 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
29146757 |
tatccttaaaaaaaaaacctagtgtatacaattaattttgccgtcaggttttgtttgagagtttccagtcgtatagcccgtcaacgtttgacataaggta |
29146856 |
T |
|
| Q |
203 |
cacaaatctaacctgttattat |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29146857 |
cacaaatctaacctgttattat |
29146878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University