View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10725_high_23 (Length: 227)

Name: NF10725_high_23
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10725_high_23
NF10725_high_23
[»] chr7 (1 HSPs)
chr7 (84-210)||(27474330-27474456)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 84 - 210
Target Start/End: Complemental strand, 27474456 - 27474330
Alignment:
84 cattgcttgacgcgaagatgaaggagatggaagagaaaagcgagattcagaagaatctcgaaattcaagtcgatcgattgttccgtttgaaggaactcaa 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27474456 cattgcttgacgcgaagatgaaggagatggaagagaaaagcgagattcagaagaatctcgaaattcaagtcgatcgattgttccgtttgaaggaactcaa 27474357  T
184 atatcgatgcatggtgcgcaacagttt 210  Q
    ||||||||||||||||||||| |||||    
27474356 atatcgatgcatggtgcgcaaaagttt 27474330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University