View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10725_high_25 (Length: 222)
Name: NF10725_high_25
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10725_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 19 - 156
Target Start/End: Original strand, 52140746 - 52140883
Alignment:
| Q |
19 |
tagtggaagatgtatagaaaattgtaaaagtaagtttggtatttattacttagagattggaaattggaatgtatgaagtaccagtggccacggtattgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52140746 |
tagtggaagatgtatagaaaattgtaaaagtaagcttggtatttattacttagagattggaaattggaatgtatgaagtaccagtggccacggtattgct |
52140845 |
T |
|
| Q |
119 |
aatttaattcgatgtatttatgtacaaacagttgccac |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52140846 |
aatttaattcgatgtatttatgtacaaacagttgccac |
52140883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 205
Target Start/End: Original strand, 52140901 - 52140944
Alignment:
| Q |
162 |
agcttgattttgagttctcttatcctcctctgcaattggccaac |
205 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52140901 |
agcttaattttgagttctcttaatctcctctgcaattggccaac |
52140944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 89
Target Start/End: Original strand, 52131249 - 52131281
Alignment:
| Q |
57 |
gtatttattacttagagattggaaattggaatg |
89 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
52131249 |
gtatttattactaagagattggaaattggaatg |
52131281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 31 - 133
Target Start/End: Complemental strand, 17524955 - 17524854
Alignment:
| Q |
31 |
tatagaaaattgtaaaagtaagtttggtatttattacttagagattggaaattggaatgtatgaagtaccagtggccacggtattgctaatttaattcga |
130 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
17524955 |
tatagaaaattgtaaaagtaactt-ggtatttattacttagagattggaaattggaatgtatgaagtcctactggccacggtattgctaatttaattcga |
17524857 |
T |
|
| Q |
131 |
tgt |
133 |
Q |
| |
|
||| |
|
|
| T |
17524856 |
tgt |
17524854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 137 - 222
Target Start/End: Complemental strand, 17524571 - 17524476
Alignment:
| Q |
137 |
tatgtacaaacagttgccacttacgag---------cttgattttgagttctcttatcctcctctgcaattggcc-aacatttgagcaagagaaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
17524571 |
tatgtacaaacagttgccacttacgagtaattaaagcttaattttgagttctcttaatctcctctgcaattggccaaacattggagcaagagaaac |
17524476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University