View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10725_low_12 (Length: 284)
Name: NF10725_low_12
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10725_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 121 - 276
Target Start/End: Complemental strand, 393500 - 393345
Alignment:
| Q |
121 |
gagtagctttaaccataagagctaggttttgcaacttttgccaactcctgcactggaccagttgttctgttccagatgcccaatgcattttcctcacctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
393500 |
gagtagctttaaccataagagctaggttttgcaacttttgccaactcctgcactggaccagttgttctgttccagatgcccaatgcattttcctcaccgc |
393401 |
T |
 |
| Q |
221 |
aattttcaaataattgtgttatttgaacatcaaaatgcaaatatagtcttcatctc |
276 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
393400 |
aattttcaaataattatgttatttgaacatcaaaatacaaatatagtctttatctc |
393345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 8550530 - 8550478
Alignment:
| Q |
224 |
tttcaaataattgtgttatttgaacatcaaaatgcaaatatagtcttcatctc |
276 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
8550530 |
tttcaaataattatgttatttaaacatcaaaatacaaatatagtctttatctc |
8550478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University