View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10725_low_15 (Length: 256)
Name: NF10725_low_15
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10725_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 11 - 131
Target Start/End: Complemental strand, 39825702 - 39825584
Alignment:
| Q |
11 |
gtgagatgaaagagtgaatcaaatacacgacaaaatctcaactctcaaatacaaacaattttgtggccggctacttcacatgccaccaaaatccaatact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825702 |
gtgagatgaaagagtgaatcaaatacacgacaaaatctcaactc--aaatacaaacaattttgtggccggctacttcacatgccaccaaaatccaatact |
39825605 |
T |
 |
| Q |
111 |
acaatttacagattacaggta |
131 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39825604 |
acaatttacagattacaggta |
39825584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 188 - 256
Target Start/End: Complemental strand, 39825531 - 39825463
Alignment:
| Q |
188 |
tcctaacctcagaagaaaagggtatctttctcttttgtagccatgaaaatgatttctgtttttcagtac |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825531 |
tcctaacctcagaagaaaagggtatctttctcttttgtagccatgaaaatgatttctgtttttcagtac |
39825463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University