View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10725_low_28 (Length: 227)
Name: NF10725_low_28
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10725_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 84 - 210
Target Start/End: Complemental strand, 27474456 - 27474330
Alignment:
| Q |
84 |
cattgcttgacgcgaagatgaaggagatggaagagaaaagcgagattcagaagaatctcgaaattcaagtcgatcgattgttccgtttgaaggaactcaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27474456 |
cattgcttgacgcgaagatgaaggagatggaagagaaaagcgagattcagaagaatctcgaaattcaagtcgatcgattgttccgtttgaaggaactcaa |
27474357 |
T |
 |
| Q |
184 |
atatcgatgcatggtgcgcaacagttt |
210 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
27474356 |
atatcgatgcatggtgcgcaaaagttt |
27474330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University