View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10725_low_32 (Length: 219)
Name: NF10725_low_32
Description: NF10725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10725_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 39825405 - 39825205
Alignment:
| Q |
1 |
tcaaatatgttttttcgggatatgagtttattcatgatgagtctcttttagcaagaaacaagaatattattatccccacttataaacctgaaacgtcc-t |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39825405 |
tcaaatatgttttttcgggatatgagtttattcatgatcagtctcttttagcaagaaacaagaatattattatccccacttataaacctgaaacgtccct |
39825306 |
T |
|
| Q |
100 |
ttttctttcttcctttgattcatgtgcagaatttttcacataaactctactccaaaaattggatctcttcccaatgactaaggtatctactaccatatac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825305 |
ttttctttcttcctttgattcatgtgcagaatttttcacataaactctactccaaaaattggatctcttcccaatgactaaggtatctactaccatatac |
39825206 |
T |
|
| Q |
200 |
t |
200 |
Q |
| |
|
| |
|
|
| T |
39825205 |
t |
39825205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University