View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10727_high_21 (Length: 237)

Name: NF10727_high_21
Description: NF10727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10727_high_21
NF10727_high_21
[»] chr8 (1 HSPs)
chr8 (24-96)||(28703714-28703785)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 24 - 96
Target Start/End: Original strand, 28703714 - 28703785
Alignment:
24 ggtgttataaaagggacacaaatgtctagatgctagtgacaaagtttatatttctgaagatgtcgtatttgat 96  Q
    |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||    
28703714 ggtgttataaaagggacacaaatgtctagatgctagtgac-aagcttatatttctgaagatatcgtatttgat 28703785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University