View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10727_high_21 (Length: 237)
Name: NF10727_high_21
Description: NF10727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10727_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 24 - 96
Target Start/End: Original strand, 28703714 - 28703785
Alignment:
| Q |
24 |
ggtgttataaaagggacacaaatgtctagatgctagtgacaaagtttatatttctgaagatgtcgtatttgat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
28703714 |
ggtgttataaaagggacacaaatgtctagatgctagtgac-aagcttatatttctgaagatatcgtatttgat |
28703785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University