View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10727_high_4 (Length: 364)
Name: NF10727_high_4
Description: NF10727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10727_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 19 - 354
Target Start/End: Original strand, 520294 - 520616
Alignment:
| Q |
19 |
ggaacatgttgtggagcaagctcgttctctagctgagacacctacatattcagttgcctccgttgttactgtcatggtctttgtttgcttcttggttgag |
118 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
520294 |
ggaacatgctgtggagcaaggtcgttctctagctgagacacctacatattcagttgcctccgttgttactgtcatggtctttgtttgcttcttggttgag |
520393 |
T |
|
| Q |
119 |
cgttctatctatcgttttggaaaggtaaacaaaaacatacaatacaaactcatttctctaaaattaaaggagccttttgtttaaacaattattcatccct |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
520394 |
cgttctatctaccgttttggaaaggtaaacaaaaac-----atacaaactcatttctcta-----aaaggagccttttgtttaagcaattattcatccct |
520483 |
T |
|
| Q |
219 |
aattaactacttggcatgatagaataatggatagtgttgaaattggtttctatttcacataagcaagcagctcaagaagcaataatgtaaaatagtcaca |
318 |
Q |
| |
|
|||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
520484 |
aattaactacttggcatgatagaata---gttattgttgaaattggtttctatttcacataagcaagcagctcaagaagcaataatgtaaaatagtcaca |
520580 |
T |
|
| Q |
319 |
tgaactgccaaaagtaattaatgacatgttcctatg |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
520581 |
tgaactgccaaaagtaattaatgacatgttcctatg |
520616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University