View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10727_low_19 (Length: 250)
Name: NF10727_low_19
Description: NF10727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10727_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 28703311 - 28703068
Alignment:
| Q |
1 |
aataacatattctgagacc-gaccgacaattcatcgatcatagttaaatcaatcttaaatcataacaactgatggatgaaatggaaattattggcaaatg |
99 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28703311 |
aataacatattctgagaccaggccgacaattcatcgatcataattaaatcaatcttaaatcataacaattgatggatgaaatggcaattattggcaaatg |
28703212 |
T |
|
| Q |
100 |
taaaagtgattatataagtatgcagaggcaaaagaagcatatgcatattgtccttaa---ttatgtgttgccatcacgaaattacttgaaatagacatag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28703211 |
taaaagtgattatataagtatgcagaggcaaaagaagcatatgcatattgtccttaatatttatgtgttgccatcacgaaattacttgaaatagacatag |
28703112 |
T |
|
| Q |
197 |
gatgtctttagcttagtcgtcattttgcatggtctcctcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28703111 |
gatgtctttagcttagtcgtcattttgcatggtctcctcctttg |
28703068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University