View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10727_low_2 (Length: 427)
Name: NF10727_low_2
Description: NF10727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10727_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 2e-19; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 46 - 143
Target Start/End: Original strand, 17885359 - 17885456
Alignment:
| Q |
46 |
ttggtccacttggagatgttaccttaaatggtattaatttcaacattgaaggaggtacaaatctttattgggatgatcttgttaggcatcttgacaat |
143 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |||| ||||||||||||||| |||||||| |||||||| |||| |||| ||||||||||| |
|
|
| T |
17885359 |
ttggtccacttggaagtgttaccttagatggtattgattttgacattgaaggaggtagcaatctttactgggatgaccttgctaggaatcttgacaat |
17885456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 48 - 142
Target Start/End: Complemental strand, 17861185 - 17861091
Alignment:
| Q |
48 |
ggtccacttggagatgttaccttaaatggtattaatttcaacattgaaggaggtacaaatctttattgggatgatcttgttaggcatcttgacaa |
142 |
Q |
| |
|
|||||||||||| |||||||||| |||| ||| |||| ||||||||||||||||||||||||| |||||||| |||| |||| | |||||||| |
|
|
| T |
17861185 |
ggtccacttggaagtgttaccttagatggaattgattttgacattgaaggaggtacaaatctttactgggatgaccttgctagggaacttgacaa |
17861091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 46 - 143
Target Start/End: Original strand, 17845007 - 17845104
Alignment:
| Q |
46 |
ttggtccacttggagatgttaccttaaatggtattaatttcaacattgaaggaggtacaaatctttattgggatgatcttgttaggcatcttgacaat |
143 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |||| ||||||||||||||| ||||||| |||||||| |||| |||| ||||||||||| |
|
|
| T |
17845007 |
ttggtccacttggaagtgttaccttagatggtattgattttgacattgaaggaggtagcgatctttactgggatgaccttgctaggaatcttgacaat |
17845104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 46 - 142
Target Start/End: Complemental strand, 17821010 - 17820911
Alignment:
| Q |
46 |
ttggtccacttggagatgttaccttaaatggtattaatttcaacattgaagga---ggtacaaatctttattgggatgatcttgttaggcatcttgacaa |
142 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |||| ||||||||||| | |||||||||||| |||||||| |||| |||| | |||||||| |
|
|
| T |
17821010 |
ttggtccacttggaagtgttaccttagatggtattgattttgacattgaaggagctgctacaaatctttactgggatgaccttgctagggaacttgacaa |
17820911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 42 - 79
Target Start/End: Original strand, 17895417 - 17895454
Alignment:
| Q |
42 |
caagttggtccacttggagatgttaccttaaatggtat |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17895417 |
caagttggtccacttggagatgttaccttaaatggtat |
17895454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 82 - 131
Target Start/End: Complemental strand, 19136050 - 19136001
Alignment:
| Q |
82 |
atttcaacattgaaggaggtacaaatctttattgggatgatcttgttagg |
131 |
Q |
| |
|
||||| |||| |||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
19136050 |
atttcgacatcgaaggaggaacaaacctttattgggatgatcttgctagg |
19136001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University