View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10727_low_28 (Length: 218)
Name: NF10727_low_28
Description: NF10727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10727_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 6855009 - 6854806
Alignment:
| Q |
1 |
gtataaataagggaagaaaatgatagagagaaccatctttgaacgttgtagtatttcctaatgcgaagggaacccttggaggggatgttttctcctattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855009 |
gtataaataagggaagaaaatgatagagagaaccatctttgaacgttgtagtatttcctaatgtgaagggaacccttggaggggatgttttctcctattc |
6854910 |
T |
|
| Q |
101 |
gatctatttcttaaatcaggtgttctttcttggaaattcaaatcaagcttcctaacatctaccac---ttagtcaagagctggcatgtgcttgacaagta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
6854909 |
gatctatttcttaaatcaggtgttctttcttggaaattcaaatcaagcttcctaacatctaccacttattagtcaagagctggtatgtgcttgacaagta |
6854810 |
T |
|
| Q |
198 |
ggtt |
201 |
Q |
| |
|
|||| |
|
|
| T |
6854809 |
ggtt |
6854806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 6823549 - 6823594
Alignment:
| Q |
149 |
ttcctaacatctaccacttagtcaagagctggcatgtgcttgacaa |
194 |
Q |
| |
|
|||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
6823549 |
ttcctaacttctaccagttggtcaagagctggcatgtgcttgacaa |
6823594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University