View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10727_low_6 (Length: 363)
Name: NF10727_low_6
Description: NF10727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10727_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 2 - 347
Target Start/End: Complemental strand, 30599660 - 30599312
Alignment:
| Q |
2 |
gtaccatgaaactttttgtcaacggagatactcaacactaacgtattatcttaattgaggcgaccatttagttggnnnnnnn-atcataaaatgtaacat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30599660 |
gtaccatgaaattttttgtcaacggagatactcaacactaacgtattatcataattgaggcgaccatttagttggctttttgtatcataaaatgtaacat |
30599561 |
T |
|
| Q |
101 |
tatcattgatcttaaacaaatttggtttaccacttatagtaaactgcgactatgttggaattcattttgactaggtaaggtggtttatgaatgatcatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30599560 |
tatcattgatcttaaacaaatttggtttaccgcttatagtaaactgcaactatgtttgaattcattttgactgggtaaggtggtttatgaatgatcatga |
30599461 |
T |
|
| Q |
201 |
atcaaacacacaaatttatataagtttcaacgcattctattcaacacgaactgtccgtgca--caagaccgtatatcagtaaatattacacaaatacaaa |
298 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30599460 |
atcaaacacagaaatttatataagtttcaacgcattctattcaacacgaactgtcggtgcatcctagaccgtatatcagtaaatattacacaaatacaaa |
30599361 |
T |
|
| Q |
299 |
tcctactatgtctgccatagacttcatccacctctgccaaggcactact |
347 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30599360 |
tcctaccatgtctgccatagacttcatccacctctgccaaggcactact |
30599312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University