View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10728_low_3 (Length: 364)
Name: NF10728_low_3
Description: NF10728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10728_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 21 - 283
Target Start/End: Original strand, 44827934 - 44828197
Alignment:
| Q |
21 |
catcattgttagcatccaaatttaagcccctcatacaattactaattgtaacatctttattatgaaggtaacaatgttcaccacatggttctttgggacc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44827934 |
catcattgttagcatccaaatttaagcccctcatacaattactaattgtaacatctttattatgaaggtaacaatgttcaccacatggttctttgggacc |
44828033 |
T |
|
| Q |
121 |
ttcaggttcttgccaaactggttgcttttcagcctgagaagtaaaccatcaaattaatata-ttaattaataatggaagcatgcacatgttaagaaatga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44828034 |
ttcaggttcttgccaaactggttgcttttcagcctgagaagtaaaccatcaaattaatatatttaattaataatggaagcatgcacatgttaagaaatga |
44828133 |
T |
|
| Q |
220 |
atgaagaaacatgattgcttacaggatatattatcttttgagaacaaccgtgcaaaggacaatc |
283 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44828134 |
atgaagaaacatggttgcttacaggatatattatcttttgagaacaaccgtgcaaaggacaatc |
44828197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 360
Target Start/End: Original strand, 47437501 - 47437542
Alignment:
| Q |
319 |
tgatacatcaattttataccaatgcatttccctatgcttctc |
360 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
47437501 |
tgatacatcaattttataccaatgtatttccctatgtttctc |
47437542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University