View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10728_low_6 (Length: 273)
Name: NF10728_low_6
Description: NF10728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10728_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 29 - 273
Target Start/End: Complemental strand, 49514413 - 49514169
Alignment:
| Q |
29 |
gaagcaaaggttaagacgcattaaaatatcacattgaattcggtgggacggacgtatacactccttccttccatacttttctcatatgggtttccatgac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49514413 |
gaagcaaaggttaagacgcattaaaatatcacattgaattcggtgggacggacgtatacactccttccttccatacttttctcatatgggtttccatgac |
49514314 |
T |
|
| Q |
129 |
catcccaggttctcatttttagagtgctcatttggtcaccaataatgcaccaattatatacattgaatttgcaacaaaaatcagcttgtggaatggtgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49514313 |
catcccaggttctcatttttagagtgctgatttggtcaccaataatgcaccaattatatacattgaatttgcaacaaaaatcagcttgtggaatggtgat |
49514214 |
T |
|
| Q |
229 |
ggaccctgaacacagttgactttgaaaattgcttaccgcaactat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49514213 |
ggaccctgaacacagttgactttgaaaattgcttaccgcaactat |
49514169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University