View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10728_low_8 (Length: 262)
Name: NF10728_low_8
Description: NF10728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10728_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 36175845 - 36175692
Alignment:
| Q |
19 |
caagttttccttggaaattgaaacttacgttactttaagatttgtccaagcttcttttctatgatttttcttggttatactttgattagagggttatgga |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36175845 |
caagttttccttggaaattgaaacctacgttactttaagatttgtccaagcttcttttctatgatttttcttggttatactttgattagagggttatgga |
36175746 |
T |
|
| Q |
119 |
atgttcttctttgtgattaggttatggtcgtttatgatttattgatttattatca |
173 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
36175745 |
gtgttcttctttgtgattaggttatggtggtttatga-ttattgatttattatca |
36175692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University