View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10729_10 (Length: 347)
Name: NF10729_10
Description: NF10729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10729_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 2 - 320
Target Start/End: Complemental strand, 18237465 - 18237147
Alignment:
| Q |
2 |
tcccttgtgtgagcaatttccgcggttgttctctattccaagatgctagctttagggaattaagggttggacatggtgaagagtgaagttgggcgttgtc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18237465 |
tcccttgtgtgagcaatttccgcggttgttctctattccaagatgctaactttagggaattaagggttggacatggtgaagagtgaagttgggcgttgtc |
18237366 |
T |
|
| Q |
102 |
atggtgtagaactgtgctcgttgtcattgagggaagacgatgataagtggttgtggaagccagaagaggaaggcgtgggttactgaggggttgcttgttc |
201 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18237365 |
atggtgtagaagtttgctcgttgtcattgagggaagacgatgataagtggttgtggaagccggaagaggaaggtgtgggttactgaggggttgcttgttt |
18237266 |
T |
|
| Q |
202 |
tggataatgattttagtgttgcggttgaattccaactcaaatcaactttattgctttgtttaggtatctctttgtaaactcctttagaccgtgtcctttg |
301 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18237265 |
tggataatgattttagtactgcggttgaattccaactcaaatcaaccttattgctttgtttaggtatctatttgtaaactcctttagaccgtgtcctttg |
18237166 |
T |
|
| Q |
302 |
tacgagtaccgtagaaagt |
320 |
Q |
| |
|
|| |||||| ||||||||| |
|
|
| T |
18237165 |
tatgagtactgtagaaagt |
18237147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University